Kurtis Baute
If every centimeter of human history is one year, then the timeline is the length of a full marathon.
updated 5 years ago
Sources:
tinyurl.com/ynfwrfw6
Essay version of this video:
medium.com/@kurtisbaute/everything-you-need-to-know-about-climate-change-d54905cf3de3
Podcasts Mentioned:
fivefourpod.com
hottakepod.com
List of Books Mentioned:
tinyurl.com/c9r3kksv
Get Involved:
FridaysForFuture.org
https://rebellion.global/
sunrisemovement.org
350.org
DemandJustice.org
Figure out who to vote for:
Leadnow.ca
voteearthnow.com
Other Climate YouTubers to Check out:
tinyurl.com/fyu59z8x
How to make a go-bag:
ready.gov/kit
Mental Health Resources:
Suicide Hotlines (international) blog.opencounseling.com/suicide-hotlines
Support groups: goodgriefnetwork.org
Essay version of this video (Not a direct transcript, but close)
docs.google.com/document/d/1bkM0TQUCFQQNxBPWfOZenYUJaNDtgYdZidwxVSdRI_w/edit?usp=sharing
TIMESTAMPS
00:00 Part One - Science and History
18:26 Part Two - System Change
38:04 Part Three - Internal Activism
43:26 Part Four - Revolution
This video was already really long, and there are a lot of things that I didn't even mention, like diet (which varies for every single person with Crohn's) and things like ostomies (which is a huge part of life for many 'Crohnies'), but I'm still remembering how to make videos at this point, so please cut me some slack. Speaking of which, IBS stands for "Irritable* Bowel Syndrome" - my bad.
Resources:
crohnscolitisfoundation.org/what-is-ibd/newly-diagnosed
This book helped me: goodreads.com/en/book/show/7902654-how-to-be-sick
Communities for people with Crohn's (and their caregivers):
Reddit: reddit.com/r/CrohnsDisease
Discord: discord.gg/g2gcwb6
Video References:
crohnscolitisfoundation.org/what-is-crohns-disease/overview
crohnsmapvaccine.com
crohnscolitisfoundation.org/sites/default/files/legacy/assets/pdfs/surgery_brochure_final.pdf
0:00 Intro
1:40 My year of pain.
5:50 What is Crohn's?
8:25 Fundraiser
9:18 My 3 buttholes
10:53 Recovery
12:48 How to help people with Crohn's
Or listen on Spotify here: open.spotify.com/show/6bIQ97m2XEscutoYQGdXoQ
It is coming to iTunes and Stitcher, but may take another day to get there - please stay tuned.
For ongoing updates as to whats happening with the treehouse, follow me at:
twitter.com/kurtisbaute
instagram.com/kbaute
To get involved locally, you can contact Extinction Rebellion Vancouver (xrvancouver.ca) or BROKE (brokepipelinewatch.ca) where you can also donate to the cause.
Video Sources:
[1] policyalternatives.ca/sites/default/files/uploads/publications/BC%20Office/2020/10/ccpa-bc_reassessment-of-need-for-TMX-FINAL.pdf
[2] ipolitics.ca/2020/12/08/trans-mountains-profitability-depends-on-climate-action-says-budget-watchdog
Here's my referral link to Libro.fm that you can use to go pick up a book for free!
http://libro.fm/referral?rf_code=lfm205215
My referral code is: lfm205215
I highly recommend the book 'Break 'Em Up' by Zephyr Teachout, which you can pick up on Amazon if you can't find it elsewhere:
amazon.com/Break-Em-Up-Recovering-Freedom/dp/125020089X
Check out the youtube channel zentouro here along with some other great climate channels:
zentouro: youtube.com/channel/UCAz17eZxF5tD7vNOEVgegKg
Climate Adam: youtube.com/user/ClimateAdam
Hot Mess: youtube.com/channel/UCsaEBhRsI6tmmz12fkSEYdw
Our Changing Climate: youtube.com/channel/UCNXvxXpDJXp-mZu3pFMzYHQ
Levi Hildebrand: youtube.com/user/The100LH
Simon Clark: youtube.com/user/SimonOxfPhys
Sarah Karver: youtube.com/channel/UCRwMkTu8sCwOOD6_7QYrZnw
Sources:
1] npr.org/2020/02/17/806720144/jeff-bezos-pledges-10-billion-to-fight-climate-change-planets-biggest-threat
2] vox.com/future-perfect/2020/2/19/21142312/jeff-bezos-climate-change-ten-billion-philanthropy
3] theguardian.com/society/2020/sep/08/how-philanthropy-benefits-the-super-rich?CMP=fb_gu&utm_medium=Social&utm_source=Facebook&fbclid=IwAR3tXBXXdvftF27_OpNDZ3sP90S_MN7nTyM39m_CxNIAFqD3ORV7kyp340g#Echobox=1599557517
4] https://heated.world/p/bezos-breaks-his-climate-pledge?token=eyJ1c2VyX2lkIjo3MDM1Njc1LCJwb3N0X2lkIjozNTkwMTE1LCJfIjoiU0p4c3UiLCJpYXQiOjE2MDA4Nzc3MzgsImV4cCI6MTYwMDg4MTMzOCwiaXNzIjoicHViLTI0NzMiLCJzdWIiOiJwb3N0LXJlYWN0aW9uIn0.-lG09qEI9WO0FL3055A1JKjp1YDXdq-DkXAUyW2G2hg
5] theguardian.com/technology/2020/feb/05/amazon-workers-protest-unsafe-grueling-conditions-warehouse
6] grist.org/climate/beyond-climate-pledge-arena-are-amazons-climate-goals-for-real/?utm_content=buffer8a8a3&utm_medium=social&utm_source=twitter.com&utm_campaign=buffer
7] nytimes.com/2019/07/10/climate/nyt-climate-newsletter-cei.html
8] en.wikipedia.org/wiki/Amazon_(company)#:~:text=Subsidiaries,-See%20also%3A%20List&text=Amazon%20owns%20over%2040%20subsidiaries,%2C%20Teachstreet%2C%20Twitch%20and%20Zappos.
9] vox.com/the-big-idea/2018/4/9/17214752/zuckerberg-facebook-power-regulation-data-privacy-control-political-theory-data-breach-king
10] The book "Break ‘Em Up" By Zephyr Teachout
amazon.com/Facing-Climate-Emergency-Transform-Yourself/dp/0865719411/ref=sr_1_1?crid=2K80PVO3LIF0N&keywords=facing+the+climate+emergency&qid=1579795762&sprefix=facing+the+climate+emergency%2Caps%2C1296&sr=8-1
Or grab the first chapter for free here:
facingtheclimateemergency.com
Follow Margaret Klein Salamon (PhD) on twitter at:
twitter.com/ClimatePsych
Sources referenced:
medium.com/climate-movement-grand-strategy/leading-the-public-into-emergency-mode-a-new-strategy-for-the-climate-movement-d41b41df6f8e
For more info on Amita's campaign, how to vote for them, how to get involved, and how to donate to their campaign, go to: amitakuttner.ca
To vote, you need to become a green party member by Sept 3rd at the latest. It costs $10 and takes about a minute. The vote will take place online between Sept 26 to Oct 3. You need to be a Canadian citizen or permanent resident, and you need to be at least 14 years old. Please vote!
For more information on the contest, including other important dates, voting eligibility, and info on other contestants, go here:
greenparty.ca/en/leadership-contest
Thanks for watching!
Timestamps:
0:00 New Series!
1:07 Kuttner & The Green Party
2:46 Climate Change & Loss
6:54 Climate Preparedness
9:57 Just Transition
15:16 Representation in Politics
23:24 How to Help
If you are able, please donate to support this marathon of an occupation:
brokepipelinewatch.ca
Sources:
1] cnbc.com/2020/04/25/scary-visceral-unprecedented-traders-describe-oils-wild-week-and-fall-to-negative-prices.html
2] nytimes.com/2020/07/08/climate/dakota-access-keystone-atlantic-pipelines.html
3] financialpost.com/commodities/energy/insurance-company-zurich-drops-coverage-for-trans-mountain-oil-pipeline
Check out Sarah Karver's video (and show her channel some love!)
youtube.com/watch?v=OvORftURxO4
Get your hands, eyes, or ears on the book 'Youth to Power' by Jamie Margolin:
goodreads.com/book/show/52590772-youth-to-power
To support this ongoing action against the TransMountain Pipeline Expansion, you can go to:
brokepipelinewatch.ca
Lastly, yes I am losing subscribers while I'm up here (link to a graph below, which shows when I started this series and the current trend). I fully expected that would happen because YouTube has a climate change denial problem.
twitter.com/kurtisbaute/status/1295481142708035584
Thumbnail by Alan Yu
youtube.com/user/alanjhyu
and Muhammed Jaseem
twitter.com/Jasseeeem/status/1295801664507719683
#KurtisInATree #StopTMX
http://brokepipelinewatch.ca
Check out Amita Kuttner’s campaign for Leader of the Green Party of Canada: amitakuttner.ca
Climate action organizations, search for them in facebook along with your location:
Extinction Rebellion
School Strikes for Climate
Fridays for Future
The Sunrise Movement
350.org
Thumbnail and drone footage by YouTuber Alan Yu:
youtube.com/user/alanjhyu
Sources:
1] nytimes.com/2018/05/15/climate/air-conditioning.html\
2] youtube.com/watch?v=ipVxxxqwBQw
3] theguardian.com/us-news/commentisfree/2015/aug/24/hurricane-katrina-black-lives-matter-climate-justice
4] apnews.com/78e27c5e1e03b1a91f23d64735a6c65c
5] forbes.com/profile/jeff-bezos/#68c9085e1b23
6] washingtonpost.com/news/wonk/wp/2013/09/17/the-typical-american-family-makes-less-than-it-did-in-1989
7] goodreads.com/book/show/40876575-utopia-for-realists
8] oxfam.org/en/press-releases/worlds-billionaires-have-more-wealth-46-billion-people
Climate organizations near you to search for :
Extinction Rebellion
350.org
Sunrise Movement
School Strikes 4 Climate
Friday's for Future
Donate to ProtectTheInlet.ca to help fight against this pipeline.
Apologies: It's loud here so I tried something different with the recording setup today - I think it hurt the video/sound quality, and I’m sorry for that. Will go back to how I was doing it before. Thanks for sticking with me! #KurtisInATree
Sources:
1] youtu.be/XEdXgB9urN0?t=2024
2] squamishchief.com/news/local-news/is-squamish-s-carbon-capture-technology-the-solution-to-climate-change-1.23779642
3] carbonbrief.org/direct-co2-capture-machines-could-use-quarter-global-energy-in-2100
4] coastal.climatecentral.org/map/13/-123.108/49.6956/?theme=sea_level_rise&map_type=year&contiguous=true&elevation_model=best_available&forecast_year=2030&pathway=rcp45&percentile=p50&return_level=return_level_10&slr_model=kopp_2014
5] twitter.com/Squamishtown/status/1279210648422023169
6] carbonengineering.com/news-updates/68-million-investment
7] insideclimatenews.org/news/26052020/trillion-trees-climate-change
8] theguardian.com/environment/video/2019/nov/29/what-is-the-green-new-deal
9] drawdown.org
10] insideclimatenews.org/news/03082020/climate-change-scenarios-emissions?fbclid=IwAR39SDuNSUTi5xfsmC_Gbe-N8teAoQvSdzQq0NM3FsBtWulBfG21lNdCUhc
Books to read about climate change: goodreads.com/review/list/19919117-kurtis-baute?shelf=kurtis-climate-reads
To donate to this specific protest, you can to go to
http://brokepipelinewatch.ca
Lastly, to stay up to day while I'm up here, I'm on twitter at: twitter.com/kurtisbaute
100% of the funds I raise from referrals will go directly to supporting Protect The Inlet. You can also support their work directly, to help stop this pipeline at ProtectTheInlet.ca
Video from Day 1 is here: youtu.be/D3hXMsJbt3c
Sources:
1] nationalpost.com/news/canada/what-do-first-nations-really-think-about-trans-mountain
2] transmountain.com/spill-history
3] globalnews.ca/news/900601/kinder-morgan-pipeline-expansion-will-increase-tanker-traffic-nearly-seven-fold
#KurtisInATree
Twitter.com/kurtisbaute
edit: I was unaware that the area I'm hanging in is also Qayqayt territory. It hasn't been easy to put this video together in under 24 hours while in a tree - so I apologize for that, and any other mistakes.
Also, I haven't had a chance to add links to these yet, but here are some organizations you can Google, contact, and get involved with:
International Organizations:
Extinction Rebellion
350.org
Sunrise Movement
School Strikes 4 Climate
Friday's for Future
Vancouver Organizations (to be updated):
Extinction Rebellion Vancouver
International Socialists of Canada (http://socialist.ca)
If you wish to donate to an organization fighting the TMX expansion, I recommend going to
http://brokepipelinewatch.ca
#KurtisInATree #StopTMX
Sources:
1] en.wikipedia.org/wiki/Trans_Mountain_pipeline
2] epa.gov/energy/greenhouse-gases-equivalencies-calculator-calculations-and-references#:~:text=The%20average%20carbon%20dioxide%20coefficient,gallon%20barrel%20(EPA%202018).
3] worldometers.info/co2-emissions/belgium-co2-emissions/#:~:text=Fossil%20CO2%20emissions%20in%20Belgium,CO2%20emissions%20were%2093%2C293%2C472%20tons.
4] frontiersin.org/articles/10.3389/fpsyg.2019.02323/full
5] macleans.ca/politics/ottawa/why-morneau-decided-to-buy-a-pipeline-and-hopes-to-sell-it-again-soon
6] globalnews.ca/news/7131113/supreme-court-rejects-trans-mountain-challenge
To be clear about system change, here is what I'm talking about:
1) We need a 'just transition', meaning one that supports people as we switch to a green economy. For example, working class oil employees are going to need green new jobs. This means some form of universal basic income, and affordable access to education. A 'just transition' also means taking huge strides for equality (essentially everything BLM is fighting for), as low-income families, black people, and indigenous people are hit hardest by the effects of climate change.
2) We need to keep oil in the ground. Full stop.
3) We need to build renewable infrastructure. This means wind and solar, but also more energy efficient buildings, and switching basically everything to electric. It also means decreasing energy demands by building more public services such as city buses and bike lanes, instead of car infrastructure.
4) We need to tax the rich and the corporations they own. This transition is going to be expensive, and the people that should pay for it are the people who have done the most harm and benefited the most from it.
TL;DR: We need a Green New Deal.
--------------------------------------------------------------------------------------------------
--------------------------------------------------------------------------------------------------
Some climate activist groups that I think are doing great work:
Extinction Rebellion (global): https://rebellion.earth/join-us/
Sunrise Movement (USA): sunrisemovement.org
Climate Convergence (Vancouver, where I'm at): http://www.climateconvergence.ca
Follow me on social media:
twitter.com/kurtisbaute
instagram.com/kbaute
YouTube channels about the environment to subscribe to:
Climate Adam: youtube.com/user/ClimateAdam
zentouro: youtube.com/channel/UCAz17eZxF5tD7vNOEVgegKg
Hot Mess: youtube.com/channel/UCsaEBhRsI6tmmz12fkSEYdw
Our Changing Climate: youtube.com/channel/UCNXvxXpDJXp-mZu3pFMzYHQ
Levi Hildebrand: youtube.com/user/The100LH
Simon Clark: youtube.com/user/SimonOxfPhys
Sarah Karver: youtube.com/channel/UCRwMkTu8sCwOOD6_7QYrZnw
Here’s a list of books to read about climate change:
goodreads.com/review/list/19919117-kurtis-baute?shelf=kurtis-climate-reads
How to calculate yours: carbonfootprint.com/calculator.aspx
How to shrink it: nytimes.com/guides/year-of-living-better/how-to-reduce-your-carbon-footprint
--------------------------------------------------------------------------------------------------
--------------------------------------------------------------------------------------------------
Resources:
The Sustainable Economist: sustainableeconomist.com
Video Mistakes:
The kettled used 70Wh not 70kWh. I did the CO2 calculation right, I just wrote down the wrong number on the screen. Sorry!
Video Sources:
1. eia.gov/energyexplained/use-of-energy/electricity-use-in-homes.php
2. eia.gov/tools/faqs/faq.php?id=427&t=3
3. visualcapitalist.com/mapped-every-power-plant-in-the-united-states
4. cer-rec.gc.ca/nrg/ntgrtd/mrkt/nrgsstmprfls/bc-eng.html
5. jstor.org/stable/26789251
6. blog.copower.me/news/your-portfolios-dirty-secret
7. carbonfootprint.com/calculator.aspx
8. goodreads.com/book/show/7230015-how-bad-are-bananas
9. sciencedirect.com/science/article/pii/S2352550917300635?via%3Dihub
10. link.springer.com/article/10.1007/s10584-014-1169-1
11. ourworldindata.org/grapher/consumption-co2-per-capita-equity
12. ucsusa.org/resources/cooler-smarter-geek-out-data#.W-4zk-hKjD5
13. ourworldindata.org/grapher/consumption-co2-per-capita-equity)
14. http://shrinkthatfootprint.com/carbon-targets-for-your-footprint
15. researchgate.net/publication/305209345_Where_has_all_the_oil_gone_BP_branding_and_the_discursive_elimination_of_climate_change_risk
16. researchgate.net/publication/336666551_Celebrities_air_travel_and_social_norms
17. theguardian.com/environment/2015/dec/02/worlds-richest-10-produce-half-of-global-carbon-emissions-says-oxfam
0:00 Housing
2:22 Investing
3:27 Transportation
4:15 Goods
4:55 Diet
6:18 Air travel
7:40 Compared to other countries
9:50 Compared to the super rich
10:56 System change
Go see the collab we did together here:
youtu.be/w26eJX7ZwNs
If you’re thinking of harming yourself, please, PLEASE, call someone:
http://www.suicide.org/international-suicide-hotlines.html
To help you find "Personal Resilience & Empowerment in a Chaotic Climate" I'd recommend this website:
goodgriefnetwork.org
Other videos of mine about climate change:
youtube.com/playlist?list=PL1iviMOHUg86lMCsFa3tWgbjj80VIaEML
------------------------------------------------------------------------------------
If you’d like to help moderate the comments on this video then: thank you! I really appreciate it. However, I've already had an overwhelming number of people offer to help, and I'm covered for the time being. Again, thank you - it means a lot that you came here to read this.
------------------------------------------------------------------------------------
Other climate change YouTube Channels you can subscribe to:
zentouro: youtube.com/channel/UCAz17eZxF5tD7vNOEVgegKg
Hot Mess: youtube.com/channel/UCsaEBhRsI6tmmz12fkSEYdw
Our Changing Climate: youtube.com/channel/UCNXvxXpDJXp-mZu3pFMzYHQ
Levi Hildebrand: youtube.com/user/The100LH
Sarah Karver: youtube.com/channel/UCRwMkTu8sCwOOD6_7QYrZnw
Simon Clark: youtube.com/user/SimonOxfPhys/featured
Questions Timestamps (Thanks to user Dihydrousoxide)
2:42 - "Are you wearing pants?"
3:10 - "What things can I do that help the most?"
6:55 - "How does plastic polution affect climate change?"
8:44 - "Will the actions we take today be enough to forestall the effects of climate change?"
10:30 - "What has the impacts of COVID-19 been on the environment?"
14:50 - "To what extent do you think eating insects will reduce carbon emissions?"
15:47 - "Do any animals benefit from climate change?"
17:25 - "How did you learn all this and get too smart?"
18:21 - "Is flying domestically or internationally ever justifiable?"
20:40 - "Do carbon offsets work?"
23:09 - "What do you think about TeamTrees?"
26:27 - "Have you heard about the decline in insect populations?"
29:55 - "Can you play an instrument?"
31:24 - "What are some positive steps that we have taken to saving the planet?"
33:32 - "What is the carbon footprint of information stored in the cloud?"
36:19 - "What do you think of solar, wind, and nuclear energy?"
40:17 - "Educational campaigns?"
41:29 - "How do you deal with climate deniers?"
44:01 - "What do you think of fusion reactors?"
44:54 - "Is agriculture a big part of greenhouse gas emissions?"
46:43 - "How much effort and people to convince do you think it'll take to stop all carbon emissions?"
48:46 - "Does the state of climate change affect your thoughts on having children?"
55:22 - "How will the future of farmers jobs be affected?"
52:35 - "Your thoughts on Greta Thunberg?"
Follow me on Instagram: instagram.com/kbaute
Follow me on Twitter: twitter.com/kurtisbaute
Go read The Uninhabitable Earth: goodreads.com/book/show/41552709-the-uninhabitable-earth
The video I reference regarding how CO2 affects our ability to think: youtube.com/watch?v=1Nh_vxpycEA
Other videos of mine about climate change:
youtube.com/playlist?list=PL1iviMOHUg86lMCsFa3tWgbjj80VIaEML
Other climate change YouTube Channels you can subscribe to:
zentouro: youtube.com/channel/UCAz17eZxF5tD7vNOEVgegKg
Climate Adam: youtube.com/user/ClimateAdam
Hot Mess: youtube.com/channel/UCsaEBhRsI6tmmz12fkSEYdw
Our Changing Climate: youtube.com/channel/UCNXvxXpDJXp-mZu3pFMzYHQ
Levi Hildebrand: youtube.com/user/The100LH
Sarah Karver: youtube.com/channel/UCRwMkTu8sCwOOD6_7QYrZnw
Simon Clark: youtube.com/user/SimonOxfPhys
Check out zentouro's video on YouTube's Climate Denial Problem, and subscribe to her excellent channel over here: youtu.be/kZYH_MirvV8
My bike video that I reference at the start: youtube.com/watch?v=YaPa4esJJx4
The poll I reference: today.yougov.com/topics/philosophy/articles-reports/2018/04/02/most-flat-earthers-consider-themselves-religious
The YouTube search trends, which I'm leaving here for you to explore because its fun: trends.google.com/trends/explore?date=all_2008&geo=US&gprop=youtube&q=flat%20earth
Article about interviews with flat earthers at conference, demonstrating that YouTube brought them around to this belief: theguardian.com/science/2019/feb/17/study-blames-youtube-for-rise-in-number-of-flat-earthers
Follow me on Instagram: instagram.com/kbaute
Follow me on Twitter: twitter.com/kurtisbaute
Stay skeptical, and stay safe my friends!
Maybe at some point I'll get into my thoughts on YouTube a bit more, but I didn't want this to be a rant.
Lastly, thanks again to everyone who supported me on Patreon over the years! Now that I'm not trying to pull off big projects (and needing to contract videographers or buy equipment/materials), I won't be looking for funding to make it possible. So, no YouTube ads, no sponsors, no merch, no patreon - just one guy trying to share science with a world that desperately needs it.
Thank you!
Follow me on Instagram: instagram.com/kbaute
Follow me on Twitter: twitter.com/kurtisbaute
Follow me on Instagram: instagram.com/kbaute
Follow me on Twitter: twitter.com/kurtisbaute
Huge shoutout to my wonderful patrons for helping make this video possible, and especially to Krista Steichen, Craig Guy, Mariia Smyk, Sönke Schlüter, Gregory Baute, Melissa Bedford, Neil, and Ben McGill.
I made another video where I avoided touching plastic. It will also surprise you: youtube.com/watch?v=XgD9ItnBQsA
Links:
Abundance of microplastics: nationalgeographic.com/environment/2019/06/you-eat-thousands-of-bits-of-plastic-every-year
Microplastics and health: ncbi.nlm.nih.gov/pubmed/11559017
Follow me on social media:
Instagram: instagram.com/kbaute
Twitter: twitter.com/kurtisbaute
Here's a playlist of some of my other projects: youtube.com/watch?v=YaPa4esJJx4&list=PL1iviMOHUg84yc07bq1-pXOLq8ILgeSZY
How the eye evolved, and why it's a pinhole camera: youtu.be/bDaELRvL3WA
Huge thanks to Dom for joining me in this video. Check out his channel 'Domain of Science': youtube.com/user/dominicwalliman/featured
Here's the Smarter Every Day video I mentioned: youtu.be/MFzDaBzBlL0
Thanks to all my patrons for helping make this video possible, and especially Jan Šimonek, Wayne Maddison, Krista Steichen, Craig Guy, Mariia Smyk, Sönke Schlüter, Gregory Baute, Melissa Bedford, and Neftali. Also, thanks to Jana Josue Maclaren for filming me when my world was upside-down!
To help save rainforests, you can go to Rainforest Trust and donate here: rainforesttrust.org
If you don't know about him already, you should go check out Levi's channel: youtube.com/levihildebrand
Also, he is a pro over on Instagram: instagram.com/levi_hildebrand
I'm learning what instagram is, here: instagram.com/kbaute
Thanks to everyone who supports this channel over on Patreon! Special thanks to my $10 patrons: Jan Šimonek, Craig Guy, Mariia Smyk, Sönke Schlüter, Gregory Baute, Melissa Bedford, and Netfali.
Evidence of the donation coming soon (it takes time for these things to be processed) but for now, here's a super short video from the CEO of Rainforest Trust thanking you (on behalf of our YouTube Channels): youtu.be/vN4bN7CaBzk
#Amazon #ForestFires #YouTubersForEarth
Follow me:
Instagram: instagram.com/kbaute
Twitter: twitter.com/kurtisbaute
Thanks to:
• Everyone on Twitter who sent me photos of the moon that I didn't end up using in the video. Sorry!
• Jana for her camera work (instagram.com/jjosuephotos/).
• Xianny for helping this video make sense.
• Jesse for the solar system to-scale idea, and for lending me the DND figurine.
Moon image from: Vecteezy.com
This project really has changed my relationship with the moon, but I'm going to stick to my watch.
Huge pleasure to work with Dom on this project, go subscribe to his channel Every Think here: youtube.com/channel/UCGI000V6ZIAQf97MNybAaLQ
For more about Climate Change, go subscribe to zentouro here: youtube.com/user/zentouro
Additional Credits:
DOP: Rich Bertanshaw
Camera Assistant :Adam Shaikh
Continuity/Runner: Nicki Burgess
No camels were hurt during the making of this video.
http://dominouniverse.libsyn.com
You can also find the podcast on:
Stitcher: stitcher.com/podcast/kurtis-baute/domino-universe?refid=stpr
Spotify: open.spotify.com/show/7AEnQcvjQS2jl5li5strkM
Google Play: play.google.com/music/listen?u=0#/ps/Iq4afu6hriewxxppgehsjzn3ehm
iTunes: podcasts.apple.com/ca/podcast/domino-universe/id1467736817
My Website:
kurtisbaute.com
Instagram and IGTV:
instagram.com/kbaute
Jana Josue Photography:
instagram.com/jjosuephotos
Thanks for watching, and seriously you folks are great. It's been a wild ride to get here (I can't believe its been 12 years, and I also can't believe how far we've come since 246 subscribers). I'm so glad for and grateful for where things are and where they're going.
For those of you who are really keen, here is my very first YouTube video on my old channel, shot on mini-dv tapes: youtube.com/watch?v=kdYjDWJVXaI
I wanted to reduce my waste and share that process with you, so I decided the best way to do that would be to hoard my trash for 3 months. Honestly, I was quite surprised with how things turned out. I did not think it was going to be so easy to make such a big difference in my environmental footprint.
If you like this sort of video, please consider subscribing to my channel!
To learn more about how pervasive plastic is, and how it is affecting us, check out this video: youtu.be/XgD9ItnBQsA
Thanks for watching!
#ZeroWaste #EarthDay
Huge thanks to the University of Puget Sound for their help in making this video possible.
Here is a look behind the scenes for this video: youtube.com/watch?v=MkgOw1ncT-E
Foucault Pendulums probably are my favourite science experiment - how amazing is it that someone figured out how to watch the world turn just by watching a pendulum for a long time?
I'm taking a timelapse of a Foucault pendulum, in order to let you watch the world turn. This project is one of the ones that started off sounding like a great, easy idea, and over time I've realized that the reason no one has done it earlier is because it's actually extremely complicated. Anyway, I'm excited about how it is going. Now I just have a few thousand photos I need to turn into a video.
Huge thanks to the University of Puget Sound for their help and for letting me literally camp out in one of their stairwells... And thanks for watching!
You can support my educational projects on patreon: patreon.com/kurtisbaute
Also, sometimes I live-tweet them, so follow me on Twitter: twitter.com/kurtisbaute
I'm on Instagram, too, but I don't really like it.. so... I'm not going to leave a link. Okay Byyyyye!
Follow me on Instagram: instagram.com/kbaute
Follow me on Twitter: twitter.com/kurtisbaute
It turns out that plastic is pretty much in everything around us. Lets try and change that, ok? You don't need to go 100% #PlasticFree to make a big difference. Stop buying single use plastics.
---------------------------------------------------------------
Sources for the stats in this video:
Plastic in poo... nationalgeographic.com/environment/2018/10/news-plastics-microplastics-human-feces
Plastic recycling and waste: news.nationalgeographic.com/2017/07/plastic-produced-recycling-waste-ocean-trash-debris-environment
Plastic vs Fish... theguardian.com/business/2016/jan/19/more-plastic-than-fish-in-the-sea-by-2050-warns-ellen-macarthur
If you missed it, here is the guest video I did: youtube.com/watch?v=1Nh_vxpycEA
Patreon: patreon.com/kurtisbaute
Sir Stabbington's Page: kurtisbaute.com/stabbington.html
Welcome to those of you who just flooded my office! Am I supposed to thank you for doing that? I'm not sure.
I won't be live-tweeting this project, because plastic, but follow me on Twitter for other updates: twitter.com/kurtisbaute
Check out my most recent project, in which I run a marathon: youtube.com/watch?v=RYw57X1z0f0
My mission to go Zero Waste is going to be much harder in some ways than I'd expected ("how can I live without tape?!") and easier in other ways (eg. most stores have a bulk food section), but I'm going to learn a lot. The plastic-free day, however, that is just going to be much harder than I originally thought. Every time I sit down to do research on it I realize one more thing I won't be able to do.
Sigh. Wish me luck, and thanks for watching! #ZeroWaste #BreakFreeFromPlastic
The Domino Universe: youtu.be/ObngtuPFI8A
The Human Marathon: youtu.be/RYw57X1z0f0
Measuring the Earth: youtu.be/YaPa4esJJx4
Kurtis in a Jar: youtube.com/playlist?list=PL1iviMOHUg8756PdpBqr9JDUt2eiGX_xb
I gave the headline Nerd Nite talk at the Fox Cabaret last month. I wanted to summarize my experiences from 2018, and talk about how they reshaped my perspective on what it means to be a responsible human in the cosmos.
If you missed it, here is Part One: youtu.be/PoKvPkwP4mM
And Part Two: youtu.be/WkPkAUBhYNQ
Sources:
WHO's predictions on how Climate Change will cause more deaths by heat stroke and other means: http://www.who.int/news-room/fact-sheets/detail/climate-change-and-health
Scientific Consensus on Climate Change: link.springer.com/article/10.1007/s00704-015-1597-5
The carbon footprint of meat consumption: skepticalscience.com/how-much-meat-contribute-to-gw.html
The CO2 produced by a vehicle: bit.ly/2HAwL5p
Thanks for watching.
#KurtisInAJar #ClimateChange
Some problems with my homemade biodome are making carbon dioxide levels rise with every exhale. The air is slowly becoming unbreathable in here.
If you missed Part One, check it out: youtu.be/PoKvPkwP4mM
If you're considering trying this at home, don't. Seriously. I had a whole suite of health and safety equipment, and a paramedic on site.
#KurtisInAJar #Environmentalism
Part Two: youtu.be/WkPkAUBhYNQ
Part Three: youtube.com/watch?v=o7o7Jbkq5Bs
And check out Patrick's channel to learn more about the human body:
youtube.com/channel/UCSriLWQC2J6wNeWXOGlIV4w
Going into this, I had air monitors (with backups for the critical gases), blood-oxygen monitors, and a paramedic on stand-by. As you can probably tell from the fact that I'm writing this, I am okay, but again, this is dangerous, so do not try it at home.
We all need to have a better understanding of our atmosphere and how we impact it if we are going to deal with issues like climate change. So, thanks for watching!
Press the Subscribe button for more, and follow these adventures on:
Twitter: twitter.com/kurtisbaute
Facebook: facebook.com/scopeofscience
Instagram: instagram.com/kbaute
Twitter: twitter.com/kurtisbaute
Instagram: instagram.com/kbaute
Facebook: facebook.com/scopeofscience
And join in on the conversation at #KurtisInAJar
Yes. Really. I'm Serious: youtube.com/playlist?list=PL1iviMOHUg85XFVZBWCZD8-SRprwUBA74
2) I'm building a Lightning Flute!
3) Sir Stabbington, the cactus, is doing well! He has a website: kurtisbaute.com/stabbington.html
Also, I also did a different experiment that shows the same result (the sun is far away) twitter.com/kurtisbaute/status/1036255606414471168
If you haven't seen my 'measuring the earth' video, its here: youtu.be/YaPa4esJJx4
#flatearth #science
Follow me on Twitter: twitter.com/kurtisbaute
For a behind-the-scenes look at this video, check out my Podcast: http://dominouniverse.libsyn.com/03-bike-a-round-earth
The scientific method is an incredible thing. I use it to test if the Earth is flat or round, and to measure its size, with just my bike and two sticks.
Subscribing to my channel adds a drop of water to a cactus (named Sir Stabbington) in my house, and without that water, he will die. You can even go watch yourself water him in real time: kurtisbaute.com
This experiment would have been impossible without the help from Casey, Ryan, Jessica, and everyone at the Saskatchewan Science Centre. They went above and beyond with this project, and their science centre is fantastic. Check out this place! sasksciencecentre.com
Here is the poll i reference at the start: today.yougov.com/topics/philosophy/articles-reports/2018/04/02/most-flat-earthers-consider-themselves-religious
Also, I tested if the sun was far away or close to Earth. Its really far: youtu.be/39uV_lr5oD0
And I did an even easier experiment to test it again: twitter.com/kurtisbaute/status/1036255606414471168
Something I didn't get into in my video but really wanted to, is that my experiment was different than Eratosthenes' in another small but significant way. His was done on the summer solstice, and in Syene instead of using a stick and a shadow, he used a well. At solar noon the light went directly down to the bottom of the well. This is the same as if a stick cast no shadow. Since he knew that this happened every year on that day, he only had to measure one shadow, and he didn't have to line things up like I did. But, I have bikes, planes, and the internet, so I can't complain.
Thanks for watching! #aroundearthbybike #flatearth #science
I'm currently planning a trip to Regina to measure the size of the Earth. Why Regina? How will he do it!? I'm sure, or at least I hope, you have many questions. Please form some hypotheses or write some questions in the comments!
Thanks for watching :)
Follow me on Twitter: twitter.com/kurtisbaute
Many people have asked what apps I use and how, so here is the rundown. I use:
▪ To track my mood and keep a daily journal I use daylio.webflow.io
▪ A FitBit Charge 2 to track my movement, sleep, and heart rate
▪ To track what apps I’m using, its rescuetime.com
▪ I track my books with goodreads.com/user/show/19919117-kurtis-baute
▪ To track my music: https://www.last.fm/
▪ I took all of the daily photos with an SLR and organized them manually - 100% not recommended. I know there are apps that do this for you now.
▪ I organize all my data in excel, which is messy but works.
Sorry, but I *will not share my excel data sheet with you* - not even the template. The data is going to be different for everyone, depending on what you're hoping to get out of it. Lastly, be mindful of what you do with your data and who else gets to see it.
-------------------------------------------------
I’ve had an incredible couple of years making science videos on everything from the history of the universe to the music video of my MSc thesis.
But something has been missing and I’m thrilled to have finally figure it out. Science makes me see a beauty in the world that I didn’t before and I’ve realize it isn’t enough to TELL you about it. I need to show you.
That’s why I’m bringing art back into my videos. More personal narrative. More beauty. More fun.
It also means I’ll be putting more effort into Instagram, where I can show you the subtle ways that science is all around us. Check me out there: instagram.com/kbaute
This doesn’t mean I’m dumbing down the science! On the contrary, exploring science in this way makes it possible to tackle subjects that might otherwise be impenetrable and to appeal to viewers who don’t realize how much science has to offer them.
But that’s only the half of it. I’m also launching a Patreon account filled with opportunities for viewers, supporters and friends to help me make creative science videos and improve science literacy at a time when the world needs it very much.
Also, as you can imagine, it’s difficult to monetize the work I’m doing. I do it because I believe in it so strongly, not because it makes me money! But of course, it would be better if it did. That would mean I could continue doing this work full time and pursue even wilder projects that illuminate everything from the air you breathe to the history of our entire species. It would mean I can engage with more people and help them understand how science shapes their lives and our world. And that matters for the future of the planet.
So I’ve made about my journey across the arts and sciences in this new style I’m really excited about. The video explores how collecting and analyzing my personal data has made a happier human, and I hope it gets you thinking about your own happiness in a different way.
#QuantifiedSelf
If you're hoping to build something similar to this, I took inspiration and code from Becky Stern (Also, go check out her channel, its great for Makers!): youtube.com/watch?v=PheHlYwUS_w
And from high-speed water droplet photography setups like this: http://www.instructables.com/id/High-Speed-Droplet-Photography-With-an-Arduino
I wish Sir Stabbington luck on this grand adventure of his. May you, dear internet, take sweet care of him and his pokey bits. He is truly more than just a cactus, he is our mascot and I bow to him.
If you are frustrated that you can only give this poor creature one measly drop of water, you could get your friends to subscribe. After-all, a life is on the line... Just saying.
Facebook: goo.gl/73TKpX
Twitter: goo.gl/YjKZ7g
I'm working on some ways to keep him entertained, since I don't want him getting bored. More on that to come. #SirStabbington #InternetofThings
Check out the rest of my channel!
youtube.com/scopeofscience
I’m on social media!
facebook.com/scopeofscience
twitter.com/kurtisbaute
instagram.com/kbaute
reddit.com/r/scopeofscience
Support me on Patreon! patreon.com/kurtisbaute
I’m on social media!
twitter.com/kurtisbaute
facebook.com/scopeofscience
reddit.com/r/scopeofscience
instagram.com/kbaute
----------------------------------------------------------------
If you want to donate to this channel, I now accept cryptocurrencies! Also, thanks!
BTC: 1NYSD5Nbxs1pD9bqnhHForXvofRphcRdF7
BCH: 1MXZVz1Sy4xTxrGHo6dQcZtsArtjWLCyp
LTC: LUKB8Xh6nrrASH9rEmymMvjhUH3f6NWJiN
ETH: 0x02032DCF55148e06C579aB0F7C9c4241cC3ce6b8
----------------------------------------------------------------
If you want to make the recipe, you should seek counciling, but here is the key and recipe:
imgur.com/xchdIrJ
AUGACACUACCGAGAUUUUUAGCUUUAAGGCGCGGUUCAAAGCUCUUGCGGUCAUCAUAUUUGACGGAUUUAUUACGUGAUUUGCUGUUGCUCCUCCCUGCUCUGUUGCCCGUCCUUGGCCUGCGAACUACCCGCCGUCUAUUGCUCUUAAUUCCUGCGUCGUGCUCUCGACUAACUUUGGGCCUAUUGGGGUCAACGACCGGCCCCGACACGGAUAGACUCCGCAGACUCACCAGAAGGCUUACAACUACUCGGCUAGUAGGUCUCGUCAAAAGACUUGCGGUUACAUCCGUUGAGCGUACUCCUCCUCGAGGUCUGCCCUUAUUGGUUUCGCAUGCGGAACCAAUCUACCUUGCAGCCUUGAGAUCAGGGCGAAGGUUGCCGGCCCCCGGAGCUGUAGGAACAACGCCCGCUUUACCGAGAGGGCUGACAGUACUACGGGAUGGGCGUAUCGGCCUUUACAAACUGGCGCUCCUGCUCCGCUCACGACGUUUGUGUCGGCGUCCACUGCUGCGACGCCUCCGCCGGUUAGUAUAUAGGCGCCUAUUAGCACUAACCCCAACAUCUUUGGCUAGGACAGCGCUCUUACAGCUGUCGACACCUACGCAAGGUGGACGCCGUUUAAACCUACUUUCCAGGACGUUAACGGGACGAGGCCUUUUAACGCUUCUAAAGUUGGCCGGAUUCAGGGCACGCACUAGGAUACUAGUGCUAGUUACCUUAUCUGCCCUGCUACAGUUGCUUACAACGACCACCCGACUAUUAACUCUCCAACUUCCACUUCCGCGGCGGAUCAUAUACGACCCACUCCUGGAUCUUGACCUGCUGACUCUGGACCGGAUUAAAGUGAUACCUGACACUAUCGUGGUGUUAGUGCGUACAUCCGGCAAAAAGGGCCUCGUCCGCCCACUACGGACGGCACUGUAUCGCUCUCUCCUUGGGGUAUCCUUAUCCGGUCUCUCGGAAACGCGUGGUCGAUUACGUACUCGGCUGACACGUAGGCUCUUACGGCUCCUGCUCUCGGCCCUUGGUAAGAGAGCCGAGAAGACCCUGACCCUCAAUCUGCCGAAAACUUUGCGAACCGUCGCCGAAUCGUCCGCUCUAGAGAGGUUGCUUCUUACAUUGUGGACGUUGACCCGAAGAAGGCUAGUUCUACGGAUUGUUGUAAUACCCCGCCUUUCUAGAGCACGAUCUACUUUGCCGCUUCUAGUGGCUCUACUUAGAGUCCUUAGAAUUCGUACCGUCAGGUUAUAA
----------------------------------------
This is the first cake that I've ever made the recipe had 418 steps.
Genes are the recipes that make life and we have a lot of them. If you wanted to print out all of the genetic information in an
individual on paper, you'd have to fill 67 cabinets.
We have around 20,000 genes that make proteins in our bodies. And to make that a little more palatable I want you to pretend that instead of 'genes that make proteins' were talking about 'recipes that
make cakes' I'll explain.
Just like genes, recipes evolve - the good ones get passed on. If I make a cake and it tastes good, and I give the recipe to my friend, and
if they like the recipe they might pass it on to their friends, and maybe
somewhere along the line someone modifies it and puts in more sugar and that recipe gets passed on even more.
They change and they evolve over time.
But, if I made a recipe that tasted like socks and I passed that on to my friend, well, I'd be mean and also my friend probably wouldn't pass it on. So just as with recipes, if you have genes that make you
more successful (more likely to have offspring), those genes are more
likely to get passed on.
My mom passed recipes onto me and she also passed her genes on to me, roughly half of my DNA comes from my mom and from my dad and I say roughly half because I share more DNA in common with my mom than with my dad. It isn't a perfectly even split and a lot of things get garbled up when they get passed on. It's a messy process
but it's that messiness that makes me different than anyone else.
It makes my recipes different than anyone else is.
But those differences are really small. Even though it takes a whole 67
cabinets to write out my entire genome it only takes about this much, 210 pages double sided, to print out the things that make me genetically unique. If these are all recipes then this is my special
spice.
Okay so maybe by now you get the basic idea of inheritance but genetics still seems very complicated. So in order to make it as simple as a piece of cake I'm going to make a piece of cake with a
recipe that is 418 steps. If you've ever looked for cake recipes online you probably had to sift through a bunch of other stuff, there's ads, a review, comments, notes, and buried in there somewhere is the actual recipe. Our genes are a lot like that. Most of them are actually junk and just a fraction are important instructions.
The first thing you'll probably notice about this recipe is that it's only
written with four letters: A, U, C, and G. I wrote it that way because our genetic code is also made of just four letters.
So here's how I fit 20 different ingredients and 20 different measurements into those four letters... its all in the video!
Thanks for watching!
The Selfish Gene by Richard Dawkins: http://amzn.to/2DKkO7k
My primary camera: http://amzn.to/2DZO3GD
Macro Lens (for shots like the eye): http://amzn.to/2BDGBeW
How to find your blindspot: io9.gizmodo.com/5804116/why-every-human-has-a-blind-spot---and-how-to-find-yours
I’m on social media!
twitter.com/kurtisbaute
facebook.com/scopeofscience
reddit.com/r/scopeofscience
instagram.com/kbaute
If you're hoping to make your own, a word of warning: this was really hard for me! I'd recommend getting sensors that are very sensitive to light - the ones I used made it really hard to develop an image. However, if you insist, I have put some of my *extremely messy* code here, in case it may be of some use:
drive.google.com/drive/folders/1dhTycGEW9CxdPIUjBDssSclYk7hu5L3l?usp=sharing
Creationists and other evolution deniers often ask how the human eye, in all its complexity, could have possibly evolved. How does something so complicated just happen due to random events? Well, I think the part that people are missing about this case of evolution is that every step along the way is still useful for animals, it contributes to their survival.
In this video I demonstrate that process, and starting with a penny, I create photocells, sensors, cameras, and lenses, as I evolve a digital eye one step at a time. I could have done this in an even more gradual process, to emulate biology even more closely, but i think this is just as illustrative and keeps things under 10 minutes.
I built this with an arduino, some photo-resistors, some resistors, and otherwise pretty basic components that I had lying around my house. Funny enough, this project actually evolved out of wanting to make a video about weird quirks related to the human eye (our blindspot is only one of them), and then eventually somehow it ended up being a video about building a camera. Evolution!
#Evolution #HumanEye
For a behind-the-scenes look at this video, check out my Podcast: http://dominouniverse.libsyn.com/01-the-domino-universe-starts-here
If you set up a row of dominoes as a timeline of history from the Big Bang to now, and had each domino represent 1 million years it would stretch over 300 meters long. I know because thats what I did for this video. The universe is very old.
Here is some making-of-dominoes footage, if you're wondering how this universe came to be: youtu.be/eVBVhyx-XXc
If you want to expand your brain, check out the book 'Forces of Nature' by Brian Cox:
http://amzn.to/2CDdHhq
You can use this link to get free access to Audible books for a month. They have way more books than I have dominoes:
http://amzn.to/2lFdvpw
You can also find me across the internets on...
twitter.com/kurtisbaute
facebook.com/scopeofscience
reddit.com/r/scopeofscience
instagram.com/kbaute
#DominoUniverse #timeline #history
1:16 Year 0
2:01 Year 1 billion
2:38 Year 2 billion
3:18 Year 3 billion
3:58 Year 4 billion
4:37 Year 5 billion
5:17 Year 6 billion
5:55 Year 7 billion
6:40 Year 8 billion
7:17 Year 9 billion
7:56 Year 10 billion
8:40 Year 11 billion
9:23 Year 12 billion
10:03 Year 13 billion
10:37 Year 13.79 billion
Here is how I made it: youtu.be/eVBVhyx-XXc
If one domino represents 1 million years, then it'd take a row nearly 100m long to go back as far as when the nucleus of the cell evolved. So we did just that: setup 2000 dominoes as a metaphor for time.
If you like this and want to see the BIG one, let me know: subscribe, like, comment, and/or share!
A huge thanks to Science World for making this possible, go visit them in Vancouver, Canada: scienceworld.ca
Also, big thanks to Leo from GATU for translating this into Portuguese for the subtitles! Check out their science communication group: facebook.com/grupogatu
#RIPtrilobites.
Get involved:
http://www.worldtoiletday.info
If you’re a keener and want to get your hands on ALL THE SCIENCE, get more here:
YouTube: youtube.com/ScopeofScience
Facebook: facebook.com/scopeofscience
Twitter: twitter.com/kurtisbaute
Blog: http://www.scopeofscience.com