The Widest Insect in the World! The White Witch MothThe Jungle Diaries2019-11-07 | How big is the biggest insect wingspan in the world? One foot wide, wingtip to wingtip. This encounter in the rainforests of Brazil is on I'll always remember. http://www.instagram.com/phil_torresA bright YELLOW woodpecker! Aka the pikachu of woodpeckersThe Jungle Diaries2023-08-29 | ...Attracting butterflies with ROTTING FISHThe Jungle Diaries2022-07-01 | Beautiful butterflies, disgusting diets. What's not to love? Just make sure you plug your nose on this one.
Filmed by Sean FarneyRainforest Butterflies LOVE rotten bananas! (and get drunk!?)The Jungle Diaries2022-03-21 | How to find the most beautiful butterflies in the world? Use the most disgusting baits in the world, of course!
The latest from the Peruvian Amazon Rainforest we track down the Blue MorphoLeaf Cutter Ants Carry a Message For Me!The Jungle Diaries2022-02-08 | Leaf Cutter Ants are one of the most surprisingly fascinating groups of animals in the rainforest-- they can build their own roads, they are farmers of a fungus, and they can carry messages to the world!
Written, Directed, and Hosted by Phil Torres Director of photography and editor Sean Farney Science Consultant and Field Assistant Joseph See Jungle Guide and Expert Juan Carlos YattoThe Alaskan Grizzly Bear AdventureThe Jungle Diaries2021-09-21 | What better way to find a grizzly bear than to walk along the side of the river where you could run into one at any moment...
instagram.com/phil_torresFinding and Foraging Chanterelle MushroomsThe Jungle Diaries2021-01-02 | How do you track down, find, and forage chanterelle mushrooms in the pacific northwest? Scott Stimpson teaches me all his secrets to this delicious wild meal.
For more updates from the yard, forest, and jungle: instagram.com/phil_torresFirst Ever 4k footage of Silkhenge! The Return to Silkhenge IslandThe Jungle Diaries2020-01-14 | First we learned it was a spider... then we filmed the birth. Now? We have better footage and detail than EVER to try and crack the mystery of Silkhenge and WHY it has this incredible structure around it. What do you think? Leave your theory in the comments and click subscribe!
Filmed by Ryan Lagod and Phil Torres Discovery footage by Yazid Al-Nafjan
Join me and the team in the Amazon with Atlas Obscura to try and track this mystery down yourself! atlasobscura.com/unusual-trips/peru-amazonWhy Do These Birds Eat Dirt!?The Jungle Diaries2019-06-14 | The most beautiful bird in the world has a taste for mud on the side of a river. Why? I spent time with researchers and some adorable baby macaws to find out. Subscribe and click the bell! Follow on instagram for more: instagram.com/phil_torres Want to donate to the Tambopata Macaw Project? Click here: perunature.com/about-rainforest/macaw-project
Filmed by Ryan Lagod and Phil Torres at the Tambopata Research CenterSearching for Leafcutter Ants in the Amazon Rainforest!The Jungle Diaries2019-05-31 | Ever wanted an up-close view of the Amazon's greatest herbivore? Just wait until you see them THIS close. Filmed by Ryan Lagod and Phil Torres Macro footage filmed using the Venus Optics Laowa 24mm Probe LensChasing Millions of Army Ants!The Jungle Diaries2019-05-26 | What would you do if you saw a trail of millions of ants, driving into the rainforest? I followed them and discovered one of the most unique homes in the animal kingdom.
Filmed by Ryan Lagod and Phil TorresHow I Got Infected By A Bot FlyThe Jungle Diaries2019-05-19 | You may think bot flies are gross or fascinating... but you didn't know how cool and complex they were until this. I visited the California Academy of Sciences in San Francisco to meet up with a world-renowned fly expert Dr. Michelle Trautwein to learn about the little buddy growing in my back.
How many butterflies does it take to make a noise in the woods? A few million. Watch (and listen!) as these monarchs put on a show at their overwintering site in Mexico. Follow on Instagram @phil_torres for more.
This was filmed while leading a trip to visit the monarch migration with Atlas Obscura.Im Having A Bot Fly!The Jungle Diaries2019-03-31 | Part II coming soon! Find me on Instagram @phil_torres
What's life like waiting for your bot fly to grow up into an adult? This. If you spend enough time working in the tropics, eventually you get a larva known as a bot fly living in you. It’s kinda gross and amazing.
Filmed by Phil Torres and Ryan LagodButterflies Drinking Pee is Surprisingly BeautifulThe Jungle Diaries2019-03-14 | You heard right. When butterflies gather on the shore of this river in the Amazon Rainforest, they do it with purpose and with style. Follow my adventures on IG: instagram.com/phil_torres
Intro clip via Ryan Lagod.Clearwing Butterflys Gift of POISONThe Jungle Diaries2019-02-12 | Ever wonder what a romantic gift looks like in the insect world? Wonder no more... it's poison. These clearwing and tiger butterflies (Ithomiini) have evolved one of the most fascinating behaviors in the world... in the name of butterfly love.
Directed by Ryan Lagod Filmed by Ryan Lagod and Phil Torres Written and Hosted by Phil Torres
Scientific References: nature.com/articles/309707a0 ncbi.nlm.nih.gov/pmc/articles/PMC3047672 Brown, K. S. (1984). Adult-obtained pyrrolizidine alkaloids defend ithomiine butterflies against a spider predator. Nature, 309(5970), 707–709. doi:10.1038/309707a0 sci-hub.tw/10.1038/309707a0 Hartmann, T. (1999). Chemical ecology of pyrrolizidine alkaloids. Planta, 207(4), 483–495. doi:10.1007/s004250050508 sci-hub.tw/10.1007/s004250050508 Spermatophore image: https://magazine.uc.edu/editors_picks/recent_features/butterflies.htmlGalapagos Wildlife AdventureThe Jungle Diaries2018-11-14 | Galapagos Islands is famous for Darwin's research- but don't forget it's charismatic and stunning wildlife! This is what you can see in just 5 days of exploring the gorgeous place. Want to join me on an adventure out there? Check to see if we have spots available: atlasobscura.com/unusual-trips/galapagos-photo-oct-2019Marine Iguanas of the Galápagos Islands 4KThe Jungle Diaries2018-07-15 | When was the last time you stared at one of nature's most bizarre and unique creatures up close? The marine iguanas of the Galapagos Islands are the only lizards in the word that forage in the sea, eating algae growing on the rocks beneath the waves. The water is cold, so they spend a lot of time basking in the sun on the rocks like this to warm up.Butterflies drinking TURTLE TEARS!?The Jungle Diaries2018-07-14 | On sunny days in the Amazon you may get lucky while boating down the river to see this odd spectacle- dozens of butterflies swarming turtles to drink their tears. Why? Watch to find out.
This content is exclusively managed by Caters News. To license or use in a commercial player please contact licencing@catersnews.com or call +44 121 616 1100 / +1 646 380 1615Hummingbirds in Slow Motion - iPhoneX and Moment LensThe Jungle Diaries2018-06-27 | Filmed in the Cloud Forests at the base of Sumaco Volcano in Ecuador, the combination of hummingbirds at a feeder, an iPhoneX, and a Moment wide-angle lens exceeded my expectations of how to easily document nature. The Moment wide angle lens wasn't likely created with this in mind as it is great for shooting landscapes and cities, but once I realized how close you could focus it I put it to the test.
This content is exclusively managed by Caters News. To license or use in a commercial player please contact licencing@catersnews.com or call +44 121 616 1100 / +1 646 380 1615
Thanks to Dr. Jason Goldman for filming me in Quito, and Lucas Bustamante for being the best Ecuador nature guide ever. Thanks to Apple for providing the iPhone and Moment for providing the lens, they absolutely did not disappoint.The Bat Volcano of Calakmul, MexicoThe Jungle Diaries2018-04-04 | The Bat Volcano of Southern Mexico is a cave that is home to almost 4 million bats. Thanks to Rainforest Alliance for taking me there and doing critical conservation work with communities and forests in the region.The Great Monarch MigrationThe Jungle Diaries2018-01-27 | The greatest migration on Earth sends tens of millions of butterflies from all over North America down to this small forest in Mexico. Seeing this overwintering site of the monarch butterfly in real life is even more miraculous than you can imagine.
http://www.instagram.com/phil_torresThe BioBlitz of Penang Hill, MalaysiaThe Jungle Diaries2017-12-07 | I joined a team from the California Academy of Science and Universiti Sains Malaysia as they spent two weeks documenting all the species they could find in the area surrounding The Habitat of Penang Hill, Malaysia. See the full photo essay here: http://www.biographic.com/posts/sto/the-rainforest-next-doorFall Roadtrip to Upstate NY with HomeAwayThe Jungle Diaries2017-11-15 | That perfect fall road trip to upstate New York is our favorite part of every autumn in NYC. Check out our HomeAway cabin here: http://bit.ly/2zMxMQG
Song: Grows Old by ThirdstoryGiant Rolly Polly? Not Exactly...The Jungle Diaries2017-11-12 | Ever seen a giant pill millipede? These things are amazing. Filmed at The Habitat in Penang Hill, MalaysiaWILD Otters in Downtown Singapore - Best Airport Layover EverThe Jungle Diaries2017-10-22 | On my way to Malaysia I had an 8 hour layover in Singapore. After asking around for tips on what to do in the city, one activity suggested was clearly the best: go find some otters.The Proposal, Norway - Travel Diaries #3The Jungle Diaries2017-09-14 | Travel Vlog from our trip to Norway.Macro Photography Tutorial - How to Shoot on White Background in the FieldThe Jungle Diaries2017-08-01 | From the rainforests of Ecuador, I use a Canon 100mm macro and MP-E 65mm macro lens to demonstrate how I get clean, studio-like photos of insects in the field. For more of my photography, check out: instagram.com/phil_torres
Filmed by Danny Hoyt, Produced by Phil TorresHOMEAWAY IN GRANADA, NICARAGUA -TRAVEL DIARIES #2The Jungle Diaries2017-06-01 | Want to visit Granada? This place is UNREAL. We stayed in a homeaway home here: http://hmwy.co/StayHomeAwayGIANT Tailless Whip Scorpion On My Face!The Jungle Diaries2017-05-18 | To scientists, it is known as an amblypygi or tailless whip scorpion. But to me, I always end up calling it a Taylor Swift scorpion.
Want to read more about them? Check out this fantastic scientific review: http://digitalcommons.unl.edu/cgi/viewcontent.cgi?article=1056&context=bioscihebets
Filmed by Danny Hoyt and Phil TorresThe Nicaraguan HomeAway Adventure - TRAVEL DIARIES #1The Jungle Diaries2017-05-11 | We took on a weekend along the Nicaraguan coast with HomeAway, 1 hour north of San Juan del Sur. Stars, beach, surf, howler monkeys, and sun. Yeah, the place we stayed was insane. Want to stay there? Click here! http://hmwy.co/OurHomeAwayOne Week in the Tambopata RainforestThe Jungle Diaries2017-04-26 | Tambopata, Peru is one of the most biodiverse areas of the world. I went to the Tambopata Research Center leading a trip for Atlas Obscura and saw all of this amazing wildlife.Giant River Otters in PeruThe Jungle Diaries2017-04-11 | An endangered species, it is always an amazing moment when spent alongside these ottersEcuador: In the FieldThe Jungle Diaries2017-03-30 | I've worked in the rainforests of Ecuador for months at a time- and every expedition is full of nature's little surprises.
Filmed on Canon 1DX Mark II at 120fpsLongest Butterfly Net In the WorldThe Jungle Diaries2017-03-29 | I spent a few days in the Ecuadorian rainforest with Dr. Susan Finkbeiner as she uses one of the longest butterfly nets in the world to study some amazing species. Come along for the adventure, and stick around to hear her talk about her life as a scientist.
Filmed by Danny Hoyt and Phil Torres in Pimpilala, Ecuador. Filmed on Canon 1DX Mark II, 120fps during slow motion interlude.GIANT WALKING STICK INSECT in ECUADOR!The Jungle Diaries2017-03-10 | Sometimes, sticks have legs. This is the biggest walking stick I've ever seen! Found at night near the base of the Sumaco Volcano in Ecuador while staying at the Wild Sumaco Biological Field Station.Saving Nicaraguas Sea TurtlesThe Jungle Diaries2017-01-30 | I joined Paso Pacifico on the coast of Nicaragua to see what it takes to protect sea turtles as they lay their eggs. Check out their amazing work at http://www.pasopacifico.orgLets Eat Grubs! Eating Beetle Larva in the AmazonThe Jungle Diaries2017-01-15 | In many countries around the world, eating insects is almost as common as eating beef. In the Amazon, beetle larvae that grow in palm can be found roasting in almost every town's market, and for a good reason. They are tasty.
More info on health of palm weevil: ncbi.nlm.nih.gov/pmc/articles/PMC1859881BRADONS MAKE A WISH - Jungle BugsThe Jungle Diaries2017-01-13 | In 2015 I teamed up with Bradon's family, Make A Wish, and the Smithsonian Tropical Research Institute to bring Bradon, the smartest 9 year old entomologist out there, to the rainforest. I had the same dream at that age and it was such a pleasure to be there with him.
Filmed this in collaboration with Al Jazeera and Make A Wish.First Ever Video of Silkhenge Spider BirthThe Jungle Diaries2016-12-14 | Silkhenge, Mystery Web Tower, White-Picket Fence Structure- whatever the name, it is a spider egg surrounded by mystery. What species is it? What is the function? How is it made?
For any licensing requests please contact licensing@break.com
Another expedition, another clue. This time, video of the birth and a DNA barcode sequence. The sequence is open access, below:
Web tower-COI-5P GACTTTATATTTGTTATTTGGAGTATGGGCTGCTATAGTTGGGACTGCAATAAGAGTATTAATTCGAGTTGAGTTAGGGCAACCAGGAAGATTATTAGGGGATGATCAACTATATAATGTAATTGTTACTGCTCATGCTTTTATTATAATTTTTTTTATAGTAATGCCAATTTTAATTGGGGGATTTGGAAATTGATTAATTCCTATAATGTTAGGAGTACCTGATATAGCTTTTCCTCGGATAAATAATCTTAGTTTTTGATTATTACCCCCTTCTTTGTTTTTACTTTTAATTTCTTCTTTAAATGAAATAGGAGTTGGGGCTGGGTGAACAGTATACCCTCCTTTATCTTCTTTGGAAGGTCATAATAATAGATCTATAGATTTTGCTATTTTTTCTTTACATTTAGCTGGGGCATCTTCAATTATGGGAGCAATTAATTTTATTACTACAATTATAAATATACGGAGAGTAGAATTTAAAATAGAAAATATTTCTTTATTTATTTGATCTGTTTTAATTACAGCAGTACTTTTATTATTGTCTTTACCTGTATTAGCAGGTGCTATTACTATATTATTAACAGATCGTAATTTTAATACATCTTTTTTTGATCCTTCTGGAGGAGGGGACCCTGTTTTATTTCAACATTTATTT
Visit Yasuni Naitonal Park at http://www.Yasuni.ec
Special thanks to Tropical Herping for guiding us through to Yasuni. Want to visit there? Check them out: http://tropicalherping.comHow Do You Find A Howler Monkey in the Rainforest? You howl back.The Jungle Diaries2016-12-02 | In the rainforest, you *hear* howler monkeys before you ever see them. These monkeys are one of the most exciting and interactive mammals in the forest, and you can even learn to speak their language! Well, kinda...
Filmed at Mombacho Lodge and Costa Dulce in NicaraguaWhy Do Leaves Change Color?The Jungle Diaries2016-11-14 | Autumn in New York is full of colors... and science!
Filmed by Tanner Dunn and Phil TorresYasuni, The Most Biodiverse Place on EarthThe Jungle Diaries2016-10-11 | Ever wonder what it looks like in the rainforest with one of the highest densities of species on Earth? It is beautiful and awe-inspiring - but at risk.
Found out more about this beautiful place at http://www.Yasuni.ec
Filmed and Produced by Phil Torres http://www.phil-torres.com5 REASONS TO LOVE SPIDERS feat. ARACHNOPHOBIA MOVIEThe Jungle Diaries2016-09-07 | SUBSCRIBE: http://www.youtube.com/channel/UClaC4xkueyTnrJQ6IvdMlgg?sub_confirmation=1 ______________________________ Did the movie Arachnophobia make you as afraid of spiders as it made me?? It's time to get over that fear and realize how impressively amazingly cool they are. Thanks to Jules Sylvester, on of the spider trainers on the movie, for showing us why SPIDERS ARE THE BEST.
Director of Photography & Edit by Ryan Lagod Written and Produced by Phil Torres
Thanks to Diana Troya for helping film the expedition: vimeo.com/dianatroyaCuddling a Baby TayraThe Jungle Diaries2016-06-21 | Tayras are the new sloth. This baby Amazon Rainforest mammal was the first to greet us in the remote Yasuni National Park of Ecuador. Want to visit this forest? Contact my good friends at http://tropicalherping.com
A reminder- I do not condone buying animals off the black market anywhere, even if told they are babies and the mom was hunted. This may or may not be true, but purchasing them sets up a supply and demand for these animals that should just be left in the forest. This was a rare case in which this was an animal in need and a researcher came to its assistance, and didn't buy it, so I'm all for it. Learn more about Yasuni, the most biodiverse place on the planet, at http://www.yasuni.ec
Instagram: http://instagram.com/phil_torres Snpachat: phil_torres Facebook: facebook.com/philtorreslikesscience Twitter: twitter.com/phil_torresBUTTERFLY DISCOVERY in the Amazon!The Jungle Diaries2016-06-13 | A walk through the woods in the Tambopata Amazon Rainforest can turn into a discovery of a never-before-seen behavior! Aaron Pomerantz (@nextgenscientist) and I (@phil_torres) collaborated on project to solve the mystery behind this incredible butterfly. Huge thanks to http://www.perunature.com for supporting our research, go visit Tambopata and see this butterfly for yourself!
Macro video footage thanks to JB Rutagarama, macro photos by Phil Torres and Aaron Pomerantz.This Is Snapchat on a Science Expedition to the RainforestThe Jungle Diaries2016-05-13 | Follow along on snapchat! phil_torres Yes, scientists use snapchat too. These are snaps from a recent scientific expedition to the most biodiverse place on Earth, the rainforests of Yasuni National Park in Ecuador. We had occasional super slow internet while in one of the most remote and wild rainforests I've ever explored. And for that, you get to watch baby tayras, amazing frogs, sleepy birds, and snakes. Thanks to www.tropicalherping.com for helping me get there and showing me so many incredible things. Check out Yasuni at www.yasuni.ecGIANT EARTHWORM DISCOVERED IN ECUADORThe Jungle Diaries2016-05-10 | SUBSCRIBE: http://www.youtube.com/channel/UClaC4xkueyTnrJQ6IvdMlgg?sub_confirmation=1
Earthworms pop out of the ground during rainstorms everywhere... some are just bigger than others. Thanks to Lucas Bustamante and Alejandro Arteaga of Tropical Herping for leading this science expedition to the Sumaco Volcano in Ecuador. www.TropicalHerping.com